Define where the pipeline should find input data and save output data.

Path to comma-separated file containing information about the samples in the experiment.

required
type: string
pattern: ^\S+\.csv$

You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See usage docs.

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Choose the data types that should be simulated by the pipeline.

Option to simulate amplicon sequencing reads.

type: boolean

Option to simulate target capture sequencing reads.

type: boolean

Option to simulate metagenomic sequencing reads.

type: boolean

Option to simulate wholegenomic sequencing reads.

type: boolean

Options for simulating amplicon sequencing reads.

Forward primer to use with crabs_insilicopcr.

type: string
default: GTCGGTAAAACTCGTGCCAGC

Reverse primer to use with crabs_insilicopcr.

type: string
default: CATAGTGGGGTATCTAATCCCAGTTTG

Number of reads to be simulated per amplicon.

type: integer
default: 500

Length of reads to be simulated.

type: integer
default: 130

Sequencing system of reads to be simulated.

type: string

Can be 'GA1' for Genome Analyser I, 'GA2' for Genome Analyser II, 'HS10' for HiSeq 1000, 'HS20' for HiSeq 2000, 'HS25' for HiSeq 2500, 'HSXn' for HiSeqX PCR free, 'HSXt' for HiSeqX TruSeq, 'MinS' for MiniSeq TruSeq, 'MSv1' for MiSeq v1, 'MSv3' for MiSeq v3, or 'NS50' for NextSeq500 v2.

Maximum number of errors allowed in CRABS insilicoPCR primer sequences

type: number
default: 4.5

Options for simulating target capture sequencing reads.

Path to bait/probe file. Can be a fasta file or a bed file.

type: string

This parameter is mandatory if --probe_ref_name is not specified but --target_capture is specified.

Name of supported probe. Mandatory if not using --probes parameter.

type: string

Supported probes are 'Tetrapods-UCE-2.5Kv1', 'Tetrapods-UCE-5Kv1', 'Actinopterygians-0.5Kv1', 'Acanthomorphs-1Kv1', 'Arachnida-1.1Kv1', 'Coleoptera-1.1Kv1', 'Diptera-2.7Kv1', 'Hemiptera-2.7Kv1', 'Hymenoptera-1.5Kv1', 'Hymenoptera-2.5Kv2', and 'Anthozoa-1.7Kv1'

Simulate 'illumina' or 'pacbio' reads.

type: string

Median of fragment size at shearing.

type: integer
default: 500

Shape parameter of the fragment size distribution.

type: number
default: 6

Median of fragment size distribution.

type: integer
default: 1300

Shape parameter of the fragment size distribution.

type: number
default: 6

Median of target fragment size (the fragment size of the data). If specified, will override '--fmedian' and '--smedian'. Othersise will be estimated.

type: integer

Shape parameter of the effective fragment size distribution.

type: number

Number of fragments.

type: integer
default: 500000

Illumina: read length.

type: integer
default: 150

PacBio: Average (polymerase) read length.

type: integer
default: 30000

Illumina: Sequencing mode.

type: string

'pe' = paired-end, 'mp' = mate-paired and 'se' = singled-end

Options for simulating metagenomic sequencing reads.

Abundance distribution.

type: string

Can be 'uniform', 'halfnormal', 'exponential', 'lognormal', or 'zero_inflated_lognormal'

Path to tab-separated file containing abundance distribution.

type: string
pattern: ^\S+\.tsv$

The first column should contain the genome and the second column should contain abundance proportion. It's recommended that the total abundace in your file equals 1.

Coverage distribution.

type: string

Can be 'uniform', 'halfnormal', 'exponential', 'lognormal', or 'zero_inflated_lognormal'

Path to tab-separated file containing coverage information.

type: string
pattern: ^\S+\.tsv$

The first column should contain the genome and the second column should contain the coverage (e.g., use the value 20 for a coverage of 20X).

Number of reads to generate.

type: string
default: 1M

Supported suffixes are 'k', 'K', 'm', 'M', 'g', and 'G'.

Can be 'kde', or 'basic'.

type: string

Set this to basic if you don't want to use a model with --metagenome_model.

Can be 'HiSeq', 'NovaSeq', or 'MiSeq'.

type: string

Use this option to prevent simulating reads that have abnormal GC content.

type: boolean

Options for simulating wholegenome sequencing reads.

The base error rate.

type: number
default: 0.02

The outer distance between the two ends.

type: integer
default: 500

The standard deviation.

type: integer
default: 50

The number of read pairs.

type: integer
default: 1000000

The length of the first reads.

type: integer
default: 70

The length of the second reads.

type: integer
default: 70

The rate of mutations.

type: number
default: 0.001

The fraction of indels.

type: number
default: 0.15

The probability that an indel is extended.

type: number
default: 0.3

Reference genome related files and options required for the workflow.

Name of iGenomes reference.

type: string

If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. --genome GRCh38.

See the nf-core website docs for more details.

Path to reference FASTA file.

type: string
pattern: ^\S+\.fn?a(sta)?(\.gz)?$

If this parameter is not used, the pipeline will download a fasta file, either using the --genome parameter or by using ncbi-genome-download (relevant parameters for ncbi-genome-download all start with --ncbidownload_).

Do not load the iGenomes reference config.

hidden
type: boolean

Do not load igenomes.config when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in igenomes.config.

Path to text file containing accession ids (one accession per row).

type: string

Path to text file containing taxids (one taxid per row).

type: string

The NCBI taxonomic groups to download. Options include 'all', 'archaea', 'bacteria', 'fungi', 'invertebrate', 'metagenomes', 'plant', 'protozoa', 'vertebrate_mammalian', 'vertebrate_other', and 'viral'. A comma-separated list is also valid (e.g., 'bacteria,viral').

type: string

The NCBI section to download. 'refseq' or 'genbank'.

type: string

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h
pattern: ^(\d+\.?\s*(s|m|h|d|day)\s*)+$

Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Display version and exit.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

The Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.

Email address for completion summary, only when pipeline fails.

hidden
type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Do not use coloured log outputs.

hidden
type: boolean

Incoming hook URL for messaging service

hidden
type: string

Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.

Custom config file to supply to MultiQC.

hidden
type: string

Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file

hidden
type: string

Custom MultiQC yaml file containing HTML including a methods description.

type: string

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

By default, parameters set as hidden in the schema are not shown on the command line when a user runs with --help. Specifying this option will tell the pipeline to show all parameters.

Validation of parameters fails when an unrecognised parameter is found.

hidden
type: boolean

By default, when an unrecognised parameter is found, it returns a warinig.

Validation of parameters in lenient more.

hidden
type: boolean

Allows string values that are parseable as numbers or booleans. For further information see JSONSchema docs.